
	Trending ▼ ICSE CBSE 10th ISC CBSE 12th CTET GATE UGC NET Vestibulares ResFinder

2003 Course Bio-Informatics (Elective I)

3 pages, 33 questions, 0 questions with responses, 0 total responses,

	pune_eng	+Fave Message
	Profile Timeline Uploads Q & A

Home > pune_eng >

Instantly get Model Answers to questions on this ResPaper. Try now!
NEW ResPaper Exclusive!

Formatting page ...

Total No. of Questions :12] [Total No. of Pages : 3 P1570 [3764]-434 B.E. (I.T.) BIO - INFORMATICS (Elective - I) Time :3 Hours] [Max. Marks : 100 Instructions to the candidates: 1) Answer any three questions from each section. 2) Answers to the two sections should be written in separate books. 3) Neat diagrams must be drawn wherever necessary. 4) Assume suitable data, if necessary. SECTION - I Q1) a) b) Explain the Central Dogma of Molecular Biology. [8] Explain the Gene Mapping Process in detail. [8] OR Q2) a) Explain the odds-likelihood form of Bayes Theorem and explain any two limitations of Bayes Theorem? [8] b) The probability of a patient having a particular genetic disease is 0.5. calculate the pretest odds? If the Likelihood ratio is given as 2.75, calculate the post-test odds? Find the probability of the patient suffering from the genetic disease? [8] Q3) a) b) Explain Microarray Spotting Process Flow? [8] What is Clustering? Explain Hierarchical Clustering. Explain K-means clustering? [8] OR Q4) a) For the given fluorescence data as x[n] in the table below, calculate mean, standard deviation and variance? [8] n 1 2 3 4 5 6 7 x [n] 3.2 1.6 4.4 3.3 2.7 1.7 6.8 P.T.O. b) Explain the concept of True Positives, True Negatives, False Positives and False Negatives. [4] c) Explain the concept of Sensitivity and Specificity along with the formulae. [2] d) Explain the concept of Receiver Operating Characteristics. Q5) a) Discuss following data mining methods in detail : i) Regression. iii) [10] Classification. ii) [2] Link Analysis. iv) Deviation Detection. b) v) Segmentation. Explain and differentiate Pattern Recognition from Pattern Discovery. [8] OR Q6) a) Explain following terms : i) Genetic Programing. ii) [16] Neural Networks. iii) Hidden Markov Models. b) iv) Decision Trees. Explain Inductive Logic Programming? [2] SECTION - II Q7) a) For the given two nucleotide sequences calculate the alignment score. Use gap penalty of (- 0.5) per gap. Assuming opening cost and extension cost of (- 0.5) each calculate the penalty gap, using this also calculate expanded gap penalty. [12] Sequence 1 : ATTCGGCATTCAGAGCTAGA Sequence 2 : ATTCGACATT----GCTAGTGGTA b) Given A =[2 3 8 4 1] and B=[9 11 1 0 2 4 5 6 7 3 2], calculate Max Value = f(A1, Bi), where, i=1, 2,....., 11. OR [3764]-434 2 [6] Q8) Explain following in brief : [18] a) DNA Probes. b) Genetic Markers. c) Applications of genetic engineering. d) Polymerase chain reaction. Q9) BLAST and FASTA are two widely used tools for sequence alignment. Explain the similarities and differences in their approach. [16] OR Q10)a) What is an E-value? You do a databank search using FASTA with an amino acid sequence as a query. The only reported match has an E-value of 10. What does this mean for the similarity of the two sequences? [8] b) Explain PSI-BLAST with the schematic. List any four applications for which PSI-BLAST can be used. [8] Q11) Explain the concept behind Collaboration and Communication. Explain clearly the hierarchy. [16] OR Q12) a) What is the significance of Biotechnology? [8] b) Discuss various factors that are responsible for degradation of ecosystem. [8] #### [3764]-434 3

Formatting page ...

Tags : Pune, Engineering, University of Pune, Engineering question papers, Pune University, previous year question papers, question papers, india, model question paper, pune university paper pattern, pune university syllabus, old question papers

pune_eng chat

Horizontal lines at:
Guest Horizontal lines at:
AutoRM Data:
Box geometries: