Trending ▼   ResFinder  

2003 Course Bioinformatics & Regulations

2 pages, 18 questions, 0 questions with responses, 0 total responses,    0    0
pune_eng
   		+Fave Message
ProfileTimelineUploadsQ & A
 Home > pune_eng >

Instantly get Model Answers to questions on this ResPaper. Try now!
NEW ResPaper Exclusive!

Formatting page ...

Total No. of Questions : 10] P1401 [Total No. of Pages :2 [3764] - 460 B.E. (Biotechnology) BIOINFORMATICS AND REGULATIONS (2003 Course) (Sem. - II) (416288) Time : 3 Hours] [Max. Marks:100 Instructions to the candidates: 1) Answer three questions from Section I and three questions from Section II. 2) Answers to the two sections should be written in separate answer books. 3) Neat diagrams should be drawn whenever necessary. 4) Figures to the right indicate full marks. SECTION - I Q1) Define databases. Classify protein databases. Write in detail about Secondary Protein databases. [18] OR Q2) Enlist Heuristic methods of sequence alignment. What is FASTA? Explain in detail about principal and working of FASTA. [18] Q3) Align the following two sequences using Needleman wunsch algorithm, and write the optimal alignment. [16] [Match +1, Mismatch - 1, Gap - 1] Seq. 1 GTAG Seq. 2 GAG OR Q4) Define Bioinformatics. Write in detail about scope, goal and applications of bioinformatics. [16] Q5) Write short notes [Any two] : a) Primary nucleotide databases. b) BLAST. c) SCOP & CATH. d) SGD & UNIGENE. [16] P.T.O. SECTION - II Q6) What is Phylogenetic Analysis? Enlist the methods used for phylogenetic analysis. Draw phylogenetic tree using Distance method for the following sequence. [18] Sequence 1 ACGCGTTGGGCGATGGCAAC Sequence 2 ACGCGTTGGGCGACGGTAAT Sequence 3 ACGCATTGAA TGATGATAAT Sequence 4 ACACATTGAG TGATAATAAT OR Q7) Explain in detail quality control and quality assurance requirements for the biotechnology products. [18] Q8) a) Align the following sequences using Dot Plot. Write the optimal alignment. [12] Seq. 1 LPAMGNDEQMILVFW Seq. 2 LPAMGILVFW b) Write in detail Profile of companies engaged in Bioinformatics tools package development. [4] OR Q9) a) b) What is Epitope analysis? Explain use of epitope prediction methods in designing synthetic vaccines. [10] What is clinical research and clinical data management? Q10)Write short notes .[Any two] a) Trademarks. c) Tradesecrets. d) [16] Patents. b) Clinical trials. kbkb [3764]-460 [6] 2

Formatting page ...

 

  Print intermediate debugging step

Show debugging info


 


Tags : Pune, Engineering, University of Pune, Engineering question papers, Pune University, previous year question papers, question papers, india, model question paper, pune university paper pattern, pune university syllabus, old question papers  

© 2010 - 2025 ResPaper. Terms of ServiceContact Us Advertise with us

 

pune_eng chat