
	Trending ▼ ICSE CBSE 10th ISC CBSE 12th CTET GATE UGC NET Vestibulares ResFinder

CBSE Class XII 2014 : BIOLOGY

11 pages, 101 questions, 0 questions with responses, 0 total responses,

	cbse12	+Fave Message
	Profile Timeline Uploads Q & A

Home > cbse12 > FOREIGN Question Papers : CBSE Board Class 12 >

Instantly get Model Answers to questions on this ResPaper. Try now!
NEW ResPaper Exclusive!

Formatting page ...

H$moS> Z . Series OSR/2 Code No. amob Z . 57/2/1 narjmWu H$moS >H$mo C ma-nwp VH$m Ho$ _wI-n >na Ad ` {bIo & Roll No. Candidates must write the Code on the title page of the answer-book. H $n`m Om M H$a b| {H$ Bg Z-n _o _w{ V n > 11 h & Z-n _| Xm{hZo hmW H$s Amoa {XE JE H$moS >Z ~a H$mo N>m C ma -nwp VH$m Ho$ _wI-n > na {bI| & H $n`m Om M H$a b| {H$ Bg Z-n _| >30 Z h & H $n`m Z H$m C ma {bIZm ew $ H$aZo go nhbo, Z H$m H $_m H$ Ad ` {bI| & Bg Z-n H$mo n T>Zo Ho$ {bE 15 {_ZQ >H$m g_` {X`m J`m h & Z-n H$m {dVaU nydm _| 10.15 ~Oo {H$`m OmEJm & 10.15 ~Oo go 10.30 ~Oo VH$ N>m Ho$db Z-n H$mo n T>|Jo Am a Bg Ad{Y Ho$ Xm amZ do C ma-nwp VH$m na H$moB C ma Zht {bI|Jo & Please check that this question paper contains 11 printed pages. Code number given on the right hand side of the question paper should be written on the title page of the answer-book by the candidate. Please check that this question paper contains 30 questions. Please write down the Serial Number of the question before attempting it. 15 minutes time has been allotted to read this question paper. The question paper will be distributed at 10.15 a.m. From 10.15 a.m. to 10.30 a.m., the students will read the question paper only and will not write any answer on the answer-book during this period. Ord {dkmZ (g mp VH$) BIOLOGY (Theory) {ZYm [aV g_` : 3 K Q>o A{YH$V_ A H$ : 70 Time allowed : 3 hours 57/2/1 Maximum Marks : 70 1 P.T.O. gm_m ` {ZX}e : (i) g^r Z A{Zdm` h & (ii) Bg Z-n _| Mma I S> A, B, C Am a D h & I S> A _| 8 Z h {OZ_| `oH$ H$m EH$ A H$ h , I S> B _| 10 Z h {OZ_| `oH$ Ho$ Xmo A H$ h , I S> C _| 9 Z h {OZ_| `oH$ Ho$ VrZ A H$ h VWm I S> D _| 3 Z h {OZ_| `oH$ Ho$ nm M A H$ h & (iii) H$moB g_J M`Z-{dH$ n (AmodaAm b Mm Bg) Cnb Y Zht h & {\$a ^r, 2 A H$m| dmbo EH$ Z _|, 3 A H$m| dmbo EH$ Z _| Am a 5 A H$m| dmbo g^r VrZm| Zm| _| ^rVar M`Z{dH$ n {XE JE h & Eogo Zm| _| {d mWu H$mo Ho$db EH$ hr {dH$ n H$m C ma XoZm h & (iv) Ohm ^r Amd `H$ hmo, ~ZmE OmZo dmbo AmaoI gm \$-gwWao VWm g_w{MV $n _| Zm_m {H$V hm| & General Instructions : (i) All questions are compulsory. (ii) This question paper consists of four Sections A, B, C and D. Section A contains 8 questions of one mark each, Section B is of 10 questions of two marks each, Section C is of 9 questions of three marks each and Section D is of 3 questions of five marks each. (iii) There is no overall choice. However, an internal choice has been provided in one question of 2 marks, one question of 3 marks and all the three questions of 5 marks weightage. A student has to attempt only one of the alternatives in such questions. (iv) Wherever necessary, the diagrams drawn should be neat and properly labelled. 57/2/1 2 I S> A SECTION A 1. namJ- rHo$ga na na-{H $`m `m hmoVr h Am a `h {H$g H$ma _m `{_V (_ ` W) hmoVr h ? 1 Xm H$mo{eH$m Aa $Vm go nr{ S>V {H$gr `{ $ _| gm_m ` bmb a $ H$mo{eH$mE b ~r Am a Xm AmH ${V H$s `m| hmo OmVr h ? 1 What is pollen-pistil interaction and how is it mediated ? 2. Why do normal red blood cells become elongated sickle shaped structures in a person suffering from sickle cell anaemia ? 3. d {Va{jV amoJ `m hmoVm h ? EH$ CXmhaU Xr{OE & 1 What is an autoimmune disease ? Give an example. 4. H$mohoZ VWm ~mo`oa> mam a{MV g~go nhbo H ${ _ nwZ`m oJO {b{IE & DNA AUw Ho$ Xmo KQ>H$m| Ho$ Zm_ 1 Write the two components of the first artificial recombinant DNA molecule constructed by Cohen and Boyer. 5. CZ nanmofr H$mo{eH$mAm| H$m Zm_ {b{IE {OZHo$ ^rVa {dOmVr` gy _ A V jonU VH$ZrH$ B Vo_mb H$s OmVr h & DNA doe H$amZo Ho$ {bE 1 Name the host cells in which micro-injection technique is used to introduce an alien DNA. 6. CZ E OmB_m| Ho$ Zm_ {b{IE {OZH$m B Vo_mb H $_e: Ordm mw H$mo{eH$mAm| Ho$ VWm H$dH$ H$mo{eH$mAm| Ho$ DNA Ho$ n W $aU Ho$ {bE {H$`m OmVm h & 1 Write the names of the enzymes that are used for isolation of DNA from bacterial and fungal cells respectively for Recombinant DNA Technology. 7. 1 _m Q >r`b moQ>moH$mob na h Vmja H$aZo H$m C o ` ~VmBE & State the purpose of signing the Montreal Protocol. 8. Zm{^H$s` D$Om Ho$ X fUH$mar Z hmoVo h E ^r {~Obr C nmXZ Ho$ {bE BgHo$ B Vo_mb na ^mar Ame H$mE ~Zr h B h , Eogm `m| ? 1 In spite of being non-polluting, why are there great apprehensions in using nuclear energy for generating electricity ? 57/2/1 3 P.T.O. I S> B SECTION B 9. {H$ ht Eogo Xmo OrdYm[a`m| Ho$ Zm_ Am a {Z{hV n[aKQ>Zm {b{IE {OZ_| {~Zm {ZfoMZ h E hr _mXm `w _H$ _| n[adY Z hmoH$a ZE Ord ~Z OmVo h & 2 Name any two organisms and the phenomenon involved where the female gamete undergoes development to form new organisms without fertilization. 10. 2 EH$ CXmhaU XoVo h E OrZ ~h ^m{dVm Ho$ {df` _| g_PmBE & Explain pleiotropy with the help of an example. 11. ZrMo EH$ $nXm a mwH$ {X`m J`m h & CgHo$ AZw $nr H$moS>rH$aU Am a ~Z gH$Zo dmbo mRNA a mwH$m| H$mo CZH$s Y wdVm g{hV {b{IE & 2 3 ATGCATGCATGCATGCATGCATGC 5 AWdm ZrMo {XE Om aho {M m| H$m A ``Z H$s{OE Am a nyN>o Om aho Z H$m C ma Xr{OE : nhMmZH$a ~VmBE {H$ {H$g g H$aU _| OrZm| Ho$ ~rM H$s ghb ZVm e{ $ C Va h & AnZo C ma Ho$ g_W Z _| H$maU ~VmBE & A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be formed, along with their polarity. 3 ATGCATGCATGCATGCATGCATGC 5 OR 57/2/1 4 2 Study the figures given below and answer the question. Identify in which of the crosses is the strength of linkage between the genes higher. Give reasons in support of your answer. 12. OrdmUw amB~mogmo_ _| no Q>mBS> ~ Y {Z_m U H$hm hmoVm h Am a {H$g H$ma hmoVm h ? 2 Where does peptide bond formation occur in a bacterial ribosome and how ? 13. AnZ`Z qgS >mo_ {H$go H$hVo h ? BgHo$ H$moB Xmo {d{e Q> amoJbjU {b{IE & 2 What is withdrawal syndrome ? List any two symptoms it is characterised by. 14. AnwZ`m oJOm| go nwZ`m}JOm| H$m {d^oXZ H$aZo Ho$ {bE {H$gr E OmB_ H$m {Zdoer` {Zp H $`H$aU daUm _H$ {M H$ Ho$ $n _| {H$g H$ma B Vo_mb {H$`m OmVm h ? 2 How is insertional inactivation of an enzyme used as a selectable marker to differentiate recombinants from non-recombinants ? 15. A_o[aH$s H$ nZr E{b {b r Zo nwZ`m oJO C nmXZ {H$`m Wm, g_PmBE & DNA m mo{JH$s mam B gw{bZ H$m {H$g H$ma 2 Explain how Eli Lilly, an American company, produced insulin by recombinant DNA technology. 16. g_p Q> (OZg `m) H$s doah Q>-nb g ^ma d { `m hmoVr h , g_PmBE & 2 Explain Verhulst-Pearl Logistic Growth of a population. 17. Ho$db nm Ym| go EH$-EH$ CXmhaU boH$a g_PmBE {H$ gh^mo{OVm VWm ghmonH$m[aVm (na na{hVVm) _| `m A Va h & 2 Differentiate between commensalism and mutualism by taking one example each from plants only. 18. \$gbr nm Ym| _ o H ${ _ g H$aU H$amZo _| H$m Z-H$m Z go Xmo MaU A{Zdm` h , gyMr ~ZmBE, Am a do Eogm `m| h , `h ^r {b{IE & 2 List the two steps that are essential for carrying out artificial hybridization in crop plants and why. 57/2/1 5 P.T.O. I S> C SECTION C 19. dm`w-nam{JV VWm H$sQ>-nam{JV \y$bm| _| `m- `m {^ VmE hmoVr h , {b{IE & `oH$ H$ma H$m EH$-EH$ CXmhaU Xr{OE & 3 Write the differences between wind-pollinated and insect-pollinated flowers. Give an example of each type. 20. ? (a) _mZd _mXm _| Anam H $go ~ZVm h (b) Bggo m{dV hmoZo dmbo {H$ ht Xmo hm _m}Zm| Ho$ Zm_ {b{IE Am a do Eogo hm| Omo AJ^ dVr r _| ^r h Am H$aVo h & (a) 21. How is placenta formed in the human female ? (b) 3 Name any two hormones which are secreted by it and are also present in a non-pregnant woman. _mZd ewH $mUw H$m AmaoI ~ZmBE & Bg_| Ho$db CZ ^mJm| H$m Zm_m H$Z H$s{OE Ed C ht Ho$ H$m`m] H$m dU Z ^r H$s{OE, Omo _mXm `w _H$ VH$ nh MZo Am a Cg_| doe H$aZo _| ewH $mUw H$s ghm`Vm H$aVo h & 3 Draw a diagram of a human sperm. Label only those parts along with their functions, that assist the sperm to reach and gain entry into the female gamete. 22. (a) _|S>b Zo _Q>a Ho$ nm Ym| na Omo EH$g H$a g H$aU {H$E Wo CZHo$ AmYma na dh {deofH$m| H$s ^m{dVm Ho$ {OZ {Z H$fm o na nh Mm C h| {b{IE & (b) Eogm `m| h {H$ H$moB A ^mdr Eobrb ({dH$ nr) d` H$mo {df_`w _Or Ad Wm _ o A{^ ` $ Zht H$a gH$Vm, g_PmBE & (a) Write the conclusions Mendel arrived at on dominance of traits on the basis of monohybrid crosses that he carried out in pea plants. (b) 57/2/1 Explain why a recessive allele is unable to express itself in a heterozygous state. 6 3 23. bm _mo{S>`_ Ho$ Cg d $n H$m Zm_ {b{IE Omo _mZd eara _| {d Q> h Am H$aVm h & _mZd eara _| BgHo$ OrdZ-MH $ H$s {d{^ Ad WmE g_PmBE & 3 AWdm (a) H$mobmo Q >_ (Zd V `) VWm Q>rH$mH$aUm| go ZdOmV H$mo XmZ hmoZo dmbr {Vajm Ho$ H$ma H$m Zm_ {b{IE Am a H$maU ~VmVo h E CgHo$ {df` _ o g_PmBE & (b) {Z Z{b{IV _ o nmE OmZo dmbo E|Q>r~m S>r ( {VqnS>) Ho$ $n H$m Zm_ {b{IE (i) (ii) : 3 H$mobmo Q >_ _| nmE OmZo dmbo _mZd eara _| EbO Zm| H$s AZw{H $`m go ~ZZo dmbo Name the form of Plasmodium that gains entry into the human body. Explain the different stages of its life-cycle in the human body. OR (a) Name and explain giving reasons, the type of immunity provided to the newborn by the colostrum and vaccinations. (b) Name the type of antibody (i) (ii) 24. present in colostrum produced in response to allergens in human body. ZrMo Xr Om ahr Vm{bH$m _| a, b, c, d, e VWm f H$mo nhMm{ZE, do `m h : Ord H$m d km{ZH$ Zm_ ~Zm`m J`m C nmX _mZd H$ `mU _| Cn`moJ Q >o Q>moH$m H$g Q >o Q>moH$mBZo O {Ogo ~mX _| $nm V[aV {H$`m J`m a b gmB bmo nmo[aZ A c _moZ H$g na `y[a`g d e bo Q>mo~ {gbg 57/2/1 3 f X Y H$mo Xhr _| ~Xb XoVm h 7 P.T.O. Identify a, b, c, d, e and f in the table given below : Scientific Name of the organism Use in human welfare Streptococcus Streptokinase that was later modified a b Cyclosporin A c Monascus purpureus d e Lactobacillus 25. Product produced f sets milk into curd (a) nm br_ao O MoZ [aEo eZ (PCR) _| {Z{hV VrZ MaU `m- `m h , gyMr ~ZmBE & (b) Taq nm br_ao O Ho$ moV Ord H$m Zm_ {b{IE & ^y{_H$m `m h , g_PmBE & PCR _| Bg E OmB_ H$s {d{e Q> (a) 26. List the three steps involved in Polymerase Chain Reaction (PCR). (b) 3 Name the source organism of Taq polymerase. Explain the specific role of this enzyme in PCR. O d- ~brH$aU {H$go H$hVo h ? BgH$m _h d ~VmBE & ^maVr` H ${f AZwg YmZ g WmZ H$m Bg_| `m `moJXmZ ahm h , Xmo CXmhaUm| H$s ghm`Vm go Bgo ~VmBE & 3 What is biofortification ? Write its importance. Mention the contribution of Indian Agricultural Research Institute towards it with the help of two examples. 27. 57/2/1 Bg g_` {X r H$s dm`w H$s JwUd mm Cggo H$ht `mXm C V hmo J`r h {OVZr {H$ 1997 go nhbo h Am H$aVr Wr & Eogm hmoZm ~h V `mXm gMoVZ _mZd `mgm| H$m n[aUm_ h & Amngo H$hm Om ahm h {H$ Amn AnZr ~ Vr _| EH$ OmJ $H$Vm H$m` H $_ MbmE {Og_| Amn CZ MaUm| na {Q> nUr H$a|Jo Omo {X r gaH$ma Zo dm`w JwUd mm H$mo gwYmaZo Ho$ {bE CR>mE Wo & (a) AnZr H$moB Xmo {Q> n{U`m {b{IE & (b) Eogr H$moB Xmo {d{Y`m| H$s gyMr ~ZmBE {O h| Amn AnZo H$m` H $_ _o em{_b H$aZm Mmh|Jo Vm{H$ dm`w H$s A N>r JwUd mm ~ZmE aIZm gw{Zp MV {H$`m Om gHo$ & (c) Eogo H$moB Xmo _y ` ~VmBE {O h| AmnH$m H$m` H $_ AmnH$s ~ Vr _ o ahZo dmbo bmoJm| _| n Xm H$aoJm & 8 3 Presently, air quality of Delhi has significantly improved in comparison to what existed before 1997. This is the result of a lot of conscious human efforts. You are being asked to conduct an awareness programme in your locality wherein you will comment on the steps taken by Delhi Government to improve the air quality. (a) Write any two of your comments. (b) List any two ways that you would include in your programme so as to ensure the maintenance of good quality of air. (c) State any two values your programme will inculcate in the people of your locality. I S> D SECTION D 28. (a) OrdZ Ho$ CX ^d Ho$ {df` _| Amono[aZ Ed hm S>oZ Zo `m Vm{dV {H$`m Wm ? CZHo$ Vmd H$mo Eg.Eb. {_ba Ho$ `moJ go {H$g H$ma g_W Z {_bm ? (b) H$m Z-go _mZd H $mo_mgmo_ _| (i) gdm {YH$ g `m _| OrZ hmoVo h , Am a H$m Z-go _| (ii) g~go H$_ g `m _| OrZ hmoVo h ? (c) _mZd OrZmo_ _| nhMmZo JE EH$b `yp b`moQ>mBS> ~h $nVm H$m d km{ZH$ _h d {b{IE & AWdm Jmob AmH ${V Am a nrbo a J Ho$ ~rOm| dmbo EH$ {df_`w _Or _Q>a Ho$ nm Yo H$m PwauXma Am a hao ~rOm| dmbo _Q>a Ho$ nm Yo Ho$ gmW g H$aU H$am`m J`m & (a) Bg g H$aU H$mo nZoQ> dJ _| Xem BE & (b) Bg g H$aU go m g V{V H$m bjU $n {b{IE & (c) Bg g H$aU H$mo `m H$hm OmVm h ? Bg H$ma Ho$ g H$aU H$mo H$amZo H$m C o ` ~VmBE & 57/2/1 9 5 5 P.T.O. (a) What was proposed by Oparin and Haldane on origin of life ? How did S.L. Miller s experiment support their proposal ? (b) Which human chromosome has (i) maximum number of genes, and which one has (ii) fewest genes ? Write the scientific importance of single nucleotide polymorphism identified in human genome. (c) OR A cross was carried out between a pea plant heterozygous for round and yellow seeds with a pea plant having wrinkled and green seeds. (a) (b) Write the phenotype of the progeny of this cross. (c) 29. Show the cross in a Punnett square. What is this cross known as ? State the purpose of conducting such a cross. (a) CZ gy _Ordm| H$s loUr H$m Zm_ {b{IE Omo dm{hV _b _| mH ${VH$ $n _| h Am H$aVo h Am a _b-CnMma Ho$ Xm amZ Cgo H$_ X {fV ~Zm XoVo h & dm{hV _b Ho$ { Vr`H$ CnMma Ho$ Xm amZ hmoZo dmbo {d{^ MaUm| Ho$ {df` _| g_PmBE & AWdm (b) (a) (b) _mZdm| _| nmE OmZo dmbo {H$ ht Mma bgrH$m^ A Jm| Ho$ Zm_ {b{IE Ed CZHo$ {df` _| g_PmBE & Zm_ {bIo JE bgrH$m^ A Jm| H$mo H$maU ~VmVo h E mW{_H$ AWdm { Vr`H$ bgrH$m^ A Jm| _| dJuH $V H$s{OE & (a) Name the category of microbes occurring naturally in sewage and making it less polluted during the treatment. (b) Explain the different steps involved in the secondary treatment of sewage. OR (a) (b) 57/2/1 Name and explain any four lymphoid organs present in humans. Categorise the named lymphoid organs as primary or secondary lymphoid organs, giving reasons. 10 5 5 30. (a) (b) mW{_H$ VWm { Vr`H$ nm[ap W{VH$ AZwH $_Um| _| {d^oX H$s{OE & H ${V _| hmoVo ahZo dmbo ew H$Vma ^r AZwH $_U Ho$ {d{^ MaU g_PmBE & AWdm (a) O d{d{dYVm Ho$ g ajU H$s `m| Amd `H$Vm h ? O d{d{dYVm Ho$ mg Ho$ {bE C maXm`r {H$ ht Xmo {d{Y`m| Ho$ Zm_ {b{IE Am a CZHo$ {df` _| g_PmBE & (b) between primary and secondary 5 (a) Differentiate successions. (b) 5 ecological Explain the different steps of xerarch succession occurring in nature. OR (a) (b) 57/2/1 Why is there a need to conserve biodiversity ? Name and explain any two ways that are responsible for the loss of biodiversity. 11 P.T.O. 1,500

Formatting page ...

Additional Info : CBSE Class XII Board Solved Question Paper 2014 Biology
Tags : CBSE Board 2015, Specimen Question Paper 2014 Science, Biology, solved sample mock guess question paper, cbse class XII syllabus, cbse class 12 previous years model papers., cbse, cbse papers, cbse sample papers, cbse books, portal for cbse india, cbse question bank, central board of secondary education, cbse question papers with answers, cbse model test papers, solved board question papers of cbse last year, previous years solved question papers, free online cbse solved question paper, cbse syllabus, india cbse board sample questions papers, last 10 years cbse papers, cbse question papers 2014, cbse guess sample questions papers, cbse important questions, specimen / mock papers 2015., cbse, cbse papers, cbse sample papers, cbse books, portal for cbse india, cbse question bank, central board of secondary education, cbse question papers with answers, prelims preliminary exams, pre board exam papers, cbse model test papers, solved board question papers of cbse last year, previous years solved question papers, free online cbse solved question paper, cbse syllabus, india cbse board sample questions papers, last 10 years cbse papers, cbse question papers 2017, cbse guess sample questions papers, cbse important questions, specimen / mock papers 2018.

cbse12 chat

Horizontal lines at:
Guest Horizontal lines at:
AutoRM Data:
Box geometries: